# BtToxin Pipeline

Automated Bacillus thuringiensis toxin mining system using pixi-managed environments.

## Quick Start

### Prerequisites

- [pixi](https://pixi.sh) - Modern package manager for conda environments
- Linux x86_64 (linux-64 platform)

### Installation

1. Install pixi (if not already installed):

```bash
# Linux/macOS
curl -fsSL https://pixi.sh/install.sh | bash

# Or via Homebrew
brew install pixi
```

2. Clone and setup the project:

```bash
git clone <your-repo>
cd bttoxin-pipeline

# Install all environments (digger + pipeline)
pixi install
```

This creates two isolated environments:
- `digger`: BtToxin_Digger with bioconda dependencies (perl, blast, etc.)
- `pipeline`: Python analysis tools (pandas, matplotlib, seaborn)

### Running the Pipeline

#### Full Pipeline (Recommended)

Run the complete analysis pipeline with a single command:

```bash
pixi run pipeline --fna tests/test_data/HAN055.fna
```

This executes three stages:
1. **Digger**: BtToxin_Digger toxin mining
2. **Shotter**: Toxin scoring and target prediction
3. **Plot**: Heatmap generation and report creation

#### CLI Options

```bash
pixi run pipeline --fna <file> [options]

Options:
  --fna PATH              Input .fna file (required)
  --out_root PATH         Output directory (default: runs/<stem>_run)
  --toxicity_csv PATH     Toxicity data CSV (default: Data/toxicity-data.csv)
  --min_identity FLOAT    Minimum identity threshold 0-1 (default: 0.0)
  --min_coverage FLOAT    Minimum coverage threshold 0-1 (default: 0.0)
  --disallow_unknown_families  Exclude unknown toxin families
  --require_index_hit     Keep only hits with known specificity
  --lang {zh,en}          Report language (default: zh)
  --bttoxin_db_dir PATH   Custom bt_toxin database directory
  --threads INT           Number of threads (default: 4)
```

#### Examples

```bash
# Basic run with default settings
pixi run pipeline --fna tests/test_data/C15.fna

# Strict filtering for high-confidence results
pixi run pipeline --fna tests/test_data/HAN055.fna \
  --min_identity 0.50 --min_coverage 0.60 \
  --disallow_unknown_families --require_index_hit

# English report with custom output directory
pixi run pipeline --fna tests/test_data/HAN055.fna \
  --out_root runs/HAN055_strict --lang en

# Use custom database
pixi run pipeline --fna tests/test_data/HAN055.fna \
  --bttoxin_db_dir /path/to/custom/bt_toxin
```

### Individual Stage Commands

Run stages separately when needed:

#### Digger Only

```bash
pixi run digger-only --fna <file> [options]

Options:
  --fna PATH              Input .fna file (required)
  --out_dir PATH          Output directory (default: runs/<stem>_digger_only)
  --bttoxin_db_dir PATH   Custom database directory
  --threads INT           Number of threads (default: 4)
  --sequence_type         Sequence type: nucl/orfs/prot/reads (default: nucl)
```

Example:
```bash
pixi run digger-only --fna tests/test_data/C15.fna --threads 8
```

#### Shotter (Scoring)

```bash
pixi run shotter [options]

Options:
  --toxicity_csv PATH     Toxicity data CSV
  --all_toxins PATH       All_Toxins.txt from Digger
  --output_dir PATH       Output directory
  --min_identity FLOAT    Minimum identity threshold
  --min_coverage FLOAT    Minimum coverage threshold
  --allow_unknown_families / --disallow_unknown_families
  --require_index_hit     Keep only indexed hits
```

Example:
```bash
pixi run shotter \
  --all_toxins runs/C15_run/digger/Results/Toxins/All_Toxins.txt \
  --output_dir runs/C15_run/shotter
```

#### Plot (Visualization)

```bash
pixi run plot [options]

Options:
  --strain_scores PATH    strain_target_scores.tsv from Shotter
  --toxin_support PATH    toxin_support.tsv (optional)
  --species_scores PATH   strain_target_species_scores.tsv (optional)
  --out_dir PATH          Output directory
  --cmap STRING           Colormap (default: viridis)
  --per_hit_strain NAME   Generate per-hit heatmap for specific strain
  --merge_unresolved      Merge other/unknown into unresolved
  --report_mode {summary,paper}  Report style (default: paper)
  --lang {zh,en}          Report language (default: zh)
```

Example:
```bash
pixi run plot \
  --strain_scores runs/C15_run/shotter/strain_target_scores.tsv \
  --toxin_support runs/C15_run/shotter/toxin_support.tsv \
  --out_dir runs/C15_run/shotter \
  --per_hit_strain C15 --lang en
```

## Output Structure

After running the pipeline:

```
runs/<strain>_run/
├── stage/                    # Staged input file
│   └── <strain>.fna
├── digger/                   # BtToxin_Digger outputs
│   ├── Results/
│   │   └── Toxins/
│   │       ├── All_Toxins.txt
│   │       ├── <strain>.list
│   │       ├── <strain>.gbk
│   │       └── Bt_all_genes.table
│   └── BtToxin_Digger.log
├── shotter/                  # Shotter outputs
│   ├── strain_target_scores.tsv
│   ├── strain_scores.json
│   ├── toxin_support.tsv
│   ├── strain_target_species_scores.tsv
│   ├── strain_species_scores.json
│   ├── strain_target_scores.png
│   ├── strain_target_species_scores.png
│   ├── per_hit_<strain>.png
│   └── shotter_report_paper.md
├── logs/
│   └── digger_execution.log
└── pipeline_results.tar.gz   # Bundled results
```

## Database Update

BtToxin_Digger's built-in database may be outdated. Use the latest from GitHub:

### Update Steps

```bash
mkdir -p external_dbs
rm -rf external_dbs/bt_toxin tmp_bttoxin_repo

git clone --filter=blob:none --no-checkout https://github.com/liaochenlanruo/BtToxin_Digger.git tmp_bttoxin_repo
cd tmp_bttoxin_repo

git sparse-checkout init --cone
git sparse-checkout set BTTCMP_db/bt_toxin
git checkout master

cd ..
cp -a tmp_bttoxin_repo/BTTCMP_db/bt_toxin external_dbs/bt_toxin
rm -rf tmp_bttoxin_repo
```

The pipeline automatically detects `external_dbs/bt_toxin` if present.

### Database Structure

```
external_dbs/bt_toxin/
├── db/                    # BLAST index files (required)
│   ├── bt_toxin.phr
│   ├── bt_toxin.pin
│   ├── bt_toxin.psq
│   └── ...
└── seq/                   # Source sequences (optional, for reference)
    └── bt_toxin*.fas
```

## Input File Format

`.fna` files are FASTA-format nucleotide sequence files containing bacterial genome sequences:

```
>NZ_CP010088.1 Bacillus thuringiensis strain 97-27 chromosome, complete genome
TAATGTAACACCAGTAAATATTTCATTCATATATTCTTTTAACTGTATTTTATATTCTTTCTACTCTACAATTTCTTTTA
ACTGCCAATATGCATCTTCTAGCCAAGGGTGTAAAACTTTCAACGTGTCTTTTCTATCCCACAAATATGAAATATATGCA
...
```

## Result Interpretation


### Key Output Files

**All_Toxins.txt** - Complete toxin predictions with:
- Strain, Protein ID, coordinates
- SVM/BLAST/HMM predictions
- Hit ID, alignment length, identity, E-value

**strain_target_scores.tsv** - Strain-level target predictions:
- TopOrder: Most likely target insect order
- TopScore: Confidence score (0-1)
- Per-order scores for all target orders

**toxin_support.tsv** - Per-hit contribution details:
- Individual toxin weights and contributions
- Family classification and partner status

### Toxin Rankings

- **Rank1**: Highest confidence (identity ≥78%, coverage ≥80%)
- **Rank2-3**: Moderate confidence
- **Rank4**:
 Lowest confidence predictions

### Target Orders

Common insect orders in predictions:
- **Lepidoptera**: Moths and butterflies
- **Coleoptera**: Beetles
- **Diptera**: Flies and mosquitoes
- **Hemiptera**: True bugs
- **Nematoda**: Roundworms

## Development

### Python Development Environment

For development work outside pixi:

```bash
uv venv --managed-python -p 3.12 --seed .venv
source .venv/bin/activate
uv pip install -e .
```

### Running Tests

```bash
# Run property-based tests
pixi run -e pipeline python -m pytest tests/test_pixi_runner.py -v
```

### Project Structure

```
bttoxin-pipeline/
├── pixi.toml                 # Pixi environment configuration
├── pyproject.toml            # Python package configuration
├── scripts/                  # Core pipeline scripts
│   ├── run_single_fna_pipeline.py  # Main pipeline orchestrator
│   ├── run_digger_stage.py         # Digger-only stage
│   ├── bttoxin_shoter.py           # Toxin scoring module
│   ├── plot_shotter.py             # Visualization & reporting
│   └── pixi_runner.py              # PixiRunner class
├── bttoxin/                  # Python package (CLI entry point)
│   ├── __init__.py
│   ├── api.py
│   └── cli.py
├── Data/                     # Reference data
│   └── toxicity-data.csv     # BPPRC specificity data
├── external_dbs/             # External databases (optional)
│   └── bt_toxin/             # Updated BtToxin database
├── tests/                    # Test suite
│   ├── test_pixi_runner.py   # Property-based tests
│   └── test_data/            # Test input files
├── docs/                     # Documentation
├── runs/                     # Pipeline outputs (gitignored)
├── backend/                  # FastAPI backend (optional web service)
└── frontend/                 # Vue.js frontend (optional web UI)
```

## Troubleshooting

### pixi not found

```bash
# Ensure pixi is in PATH
export PATH="$HOME/.pixi/bin:$PATH"

# Or reinstall
curl -fsSL https://pixi.sh/install.sh | bash
```

### Environment not found

```bash
# Reinstall environments
pixi install
```

### BtToxin_Digger not available

```bash
# Verify digger environment
pixi run -e digger BtToxin_Digger --help
```

### Permission errors

Ensure write permissions on output directories. The pipeline creates directories automatically.

## License

MIT License